ID: 907051191_907051203

View in Genome Browser

Spacer: -2

Left Crispr Right Crispr
Crispr ID 907051191 907051203
Species Human (GRCh38) Human (GRCh38)
Location 1:51330668-51330690 1:51330689-51330711
Sequence CCCGCGGCGACCCGCGCTCCCGC GCACCGCCGGGGGTTCTGGGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 27, 4: 230} {0: 1, 1: 0, 2: 3, 3: 16, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!