ID: 907116034_907116040

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 907116034 907116040
Species Human (GRCh38) Human (GRCh38)
Location 1:51969342-51969364 1:51969365-51969387
Sequence CCCTCCTTTCTCTGTCTATGAGG AAGGCTGTCCATGGAGACAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 33, 4: 435} {0: 1, 1: 0, 2: 0, 3: 25, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!