ID: 907185026_907185042

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 907185026 907185042
Species Human (GRCh38) Human (GRCh38)
Location 1:52602719-52602741 1:52602744-52602766
Sequence CCCCCATCCCGCGCCCGGCCCGG CGGCCCGCGGCTACGTGGCACGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 5, 3: 60, 4: 636} {0: 1, 1: 0, 2: 0, 3: 3, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!