ID: 907246718_907246724

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 907246718 907246724
Species Human (GRCh38) Human (GRCh38)
Location 1:53113663-53113685 1:53113715-53113737
Sequence CCCTGGTCAGATTGAACCTTCTG ACTCATTTTCTGTGGCCTTTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 119} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!