ID: 907305534_907305540

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 907305534 907305540
Species Human (GRCh38) Human (GRCh38)
Location 1:53510987-53511009 1:53511002-53511024
Sequence CCCGAGGGCCCACTACCTGGACC CCTGGACCACAGGATGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 9, 4: 141} {0: 1, 1: 0, 2: 0, 3: 30, 4: 269}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!