ID: 907315397_907315407

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 907315397 907315407
Species Human (GRCh38) Human (GRCh38)
Location 1:53567705-53567727 1:53567741-53567763
Sequence CCTAGCCCCAGCTGTGGCTAAAA AAGTCAGGTCATTGCTTCAGAGG
Strand - +
Off-target summary {0: 1, 1: 5, 2: 10, 3: 49, 4: 226} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!