ID: 907319248_907319259

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 907319248 907319259
Species Human (GRCh38) Human (GRCh38)
Location 1:53592522-53592544 1:53592560-53592582
Sequence CCCAGCTGTCTCCCAGCAGCCCT CTGTCTATTGGTCAACTCCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 54, 4: 488} {0: 1, 1: 0, 2: 0, 3: 7, 4: 95}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!