ID: 907321046_907321051

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 907321046 907321051
Species Human (GRCh38) Human (GRCh38)
Location 1:53602535-53602557 1:53602563-53602585
Sequence CCTGCACTTAGGAGGCTGTGTGC AGGAAGGCAGGCCCTAGAAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 221} {0: 1, 1: 1, 2: 2, 3: 31, 4: 310}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!