ID: 907393551_907393566

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 907393551 907393566
Species Human (GRCh38) Human (GRCh38)
Location 1:54174379-54174401 1:54174429-54174451
Sequence CCTCCTCAGGGCCCCTACAGCCC GGAGGAGTGATTAACCTCATGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 43, 4: 391} {0: 1, 1: 0, 2: 2, 3: 13, 4: 94}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!