ID: 907393560_907393565

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 907393560 907393565
Species Human (GRCh38) Human (GRCh38)
Location 1:54174404-54174426 1:54174428-54174450
Sequence CCTCCTTCTACATAGTAGGAGGC AGGAGGAGTGATTAACCTCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 112} {0: 1, 1: 0, 2: 0, 3: 12, 4: 200}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!