ID: 907393561_907393569

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 907393561 907393569
Species Human (GRCh38) Human (GRCh38)
Location 1:54174407-54174429 1:54174447-54174469
Sequence CCTTCTACATAGTAGGAGGCCAG ATGGGGCAGATGAGAAGTAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 6, 4: 134} {0: 1, 1: 0, 2: 4, 3: 21, 4: 311}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!