|
Left Crispr |
Right Crispr |
Crispr ID |
907453793 |
907453799 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
1:54562581-54562603
|
1:54562603-54562625
|
Sequence |
CCGGGCGGAGAGGCTCCTCACTT |
TCTCAGATGGGGCAGCTGCCGGG |
Strand |
- |
+ |
Off-target summary |
{0: 275, 1: 2694, 2: 8362, 3: 5948, 4: 4283} |
{0: 20, 1: 340, 2: 723, 3: 1614, 4: 4108} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|