ID: 907494630_907494637

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 907494630 907494637
Species Human (GRCh38) Human (GRCh38)
Location 1:54835764-54835786 1:54835786-54835808
Sequence CCACCTCCCCAGAGTTACAGGGC CAGCCTGAGAAGAGGGATGAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 8, 3: 40, 4: 234} {0: 1, 1: 0, 2: 2, 3: 43, 4: 408}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!