ID: 907597345_907597347

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 907597345 907597347
Species Human (GRCh38) Human (GRCh38)
Location 1:55732128-55732150 1:55732176-55732198
Sequence CCTGTCATCTTCTGCAGATAACT AGACTGTTACTGAACTTTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 36, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!