ID: 907710470_907710477

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 907710470 907710477
Species Human (GRCh38) Human (GRCh38)
Location 1:56876069-56876091 1:56876105-56876127
Sequence CCTGAAACGCCACCTTGTGTGTA CTGCCTTGATGGCTCTGATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58} {0: 1, 1: 1, 2: 3, 3: 21, 4: 216}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!