ID: 907741439_907741447

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 907741439 907741447
Species Human (GRCh38) Human (GRCh38)
Location 1:57170070-57170092 1:57170110-57170132
Sequence CCCTGCAACCTCTGCATCCCAGG CTTCAGCCTCCTGAGTAGCTGGG
Strand - +
Off-target summary No data {0: 4986, 1: 107758, 2: 212296, 3: 240129, 4: 147600}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!