ID: 907819370_907819381

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 907819370 907819381
Species Human (GRCh38) Human (GRCh38)
Location 1:57952238-57952260 1:57952285-57952307
Sequence CCCCTCTCTTGAGGATTGGCATG TTTGCTCATAAAGACAATGGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 20, 4: 267}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!