ID: 907862415_907862416

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 907862415 907862416
Species Human (GRCh38) Human (GRCh38)
Location 1:58366239-58366261 1:58366261-58366283
Sequence CCAGCTCAACTACGGGATGGCTG GAGTGTTTGATCCACCAGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 58} {0: 1, 1: 1, 2: 5, 3: 17, 4: 124}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!