ID: 907863028_907863035

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 907863028 907863035
Species Human (GRCh38) Human (GRCh38)
Location 1:58372114-58372136 1:58372148-58372170
Sequence CCAGGCACTTGGAAAAACCACAG CAGGCAATGAAAGCAGCTGCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 33, 3: 425, 4: 887} {0: 1, 1: 3, 2: 39, 3: 134, 4: 519}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!