ID: 907866956_907866968

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 907866956 907866968
Species Human (GRCh38) Human (GRCh38)
Location 1:58407730-58407752 1:58407776-58407798
Sequence CCCTGCAATATCTTCCTATCAGA CCTGAAATCTACCCTCTCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 182} {0: 1, 1: 0, 2: 1, 3: 17, 4: 187}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!