ID: 907893091_907893094

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 907893091 907893094
Species Human (GRCh38) Human (GRCh38)
Location 1:58654625-58654647 1:58654660-58654682
Sequence CCCCTACAGTGTTCTATATAACA ATCTTTGATAAATTAAAATGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 176} {0: 1, 1: 1, 2: 2, 3: 45, 4: 584}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!