ID: 908150487_908150488

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 908150487 908150488
Species Human (GRCh38) Human (GRCh38)
Location 1:61296255-61296277 1:61296296-61296318
Sequence CCTATCAGTATTTGACTTCAGAT TTAAACTCCCTTGAATCTCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 12, 4: 164}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!