ID: 908227215_908227223

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 908227215 908227223
Species Human (GRCh38) Human (GRCh38)
Location 1:62068036-62068058 1:62068070-62068092
Sequence CCACCCACCTCGGCCTTACACAG CAGGCGTGAGCCACCGCGCCTGG
Strand - +
Off-target summary No data {0: 24697, 1: 63253, 2: 117985, 3: 159199, 4: 166585}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!