ID: 908242894_908242898

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 908242894 908242898
Species Human (GRCh38) Human (GRCh38)
Location 1:62202842-62202864 1:62202867-62202889
Sequence CCCAGCTAAATCTGTATTTGTAG GAGACAGGGTTTCACCATGTTGG
Strand - +
Off-target summary No data {0: 31762, 1: 84237, 2: 130975, 3: 115475, 4: 69762}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!