ID: 908370037_908370046

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 908370037 908370046
Species Human (GRCh38) Human (GRCh38)
Location 1:63472494-63472516 1:63472530-63472552
Sequence CCTTCCATGGTCTCCCTCTGATG GGACGGTACTGCTGCCATCTCGG
Strand - +
Off-target summary {0: 4, 1: 89, 2: 14, 3: 27, 4: 216} {0: 125, 1: 829, 2: 365, 3: 139, 4: 530}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!