ID: 908414970_908414978

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 908414970 908414978
Species Human (GRCh38) Human (GRCh38)
Location 1:63904337-63904359 1:63904390-63904412
Sequence CCAGATGTTGGCAGAGTTGGAAG CTTTTCCTCAGGATTTCCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 31, 4: 220}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!