ID: 908435793_908435807

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 908435793 908435807
Species Human (GRCh38) Human (GRCh38)
Location 1:64104614-64104636 1:64104655-64104677
Sequence CCCCCACCCTTCAATAGGCCCTG CCTGTGTCCATGTGTTATCATGG
Strand - +
Off-target summary {0: 1, 1: 9, 2: 161, 3: 1795, 4: 5004} {0: 1, 1: 71, 2: 85, 3: 73, 4: 196}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!