ID: 908436335_908436344

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 908436335 908436344
Species Human (GRCh38) Human (GRCh38)
Location 1:64110506-64110528 1:64110552-64110574
Sequence CCATCTAATTCCCATCCTCATCT AAAAACAGGATAACAAAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 384} {0: 1, 1: 0, 2: 4, 3: 74, 4: 917}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!