ID: 908512331_908512339

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 908512331 908512339
Species Human (GRCh38) Human (GRCh38)
Location 1:64859425-64859447 1:64859467-64859489
Sequence CCTCACACATTGCCCATCACCAG GCCAGTTCTGAGATGCAGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 231} {0: 1, 1: 0, 2: 1, 3: 18, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!