ID: 908546629_908546632

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 908546629 908546632
Species Human (GRCh38) Human (GRCh38)
Location 1:65168580-65168602 1:65168614-65168636
Sequence CCACATCTGGCCTGCTCTCCATA TTCTAAATAAACACATTATTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 41, 4: 337} {0: 1, 1: 0, 2: 0, 3: 57, 4: 543}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!