ID: 908560138_908560142

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 908560138 908560142
Species Human (GRCh38) Human (GRCh38)
Location 1:65298036-65298058 1:65298050-65298072
Sequence CCTTTAAAAAAAACCCTAGTGTC CCTAGTGTCTGAATTTTCCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 19, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!