ID: 908586697_908586700

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 908586697 908586700
Species Human (GRCh38) Human (GRCh38)
Location 1:65577687-65577709 1:65577736-65577758
Sequence CCATCACATCATCAATTTTGTTT ACTTGGACCTTGAGTGAATCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 34, 4: 505} {0: 1, 1: 0, 2: 0, 3: 8, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!