ID: 908643082_908643090

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 908643082 908643090
Species Human (GRCh38) Human (GRCh38)
Location 1:66246755-66246777 1:66246801-66246823
Sequence CCTCATGACACTCCTCTGTGGGA GAGACAAAGCTCTGCAGCCTTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 23, 4: 190} {0: 1, 1: 1, 2: 2, 3: 47, 4: 838}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!