ID: 908645969_908645972

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 908645969 908645972
Species Human (GRCh38) Human (GRCh38)
Location 1:66278278-66278300 1:66278317-66278339
Sequence CCTGCTTATGGGGCCAGAGAAAC TGCCCAGCTGCTACAGCTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 152} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!