ID: 908669804_908669810

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 908669804 908669810
Species Human (GRCh38) Human (GRCh38)
Location 1:66533792-66533814 1:66533825-66533847
Sequence CCCCTCCGCAGCGAGCCACTTAG CACGCCAGAGTCCCCTGTTAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 45} {0: 1, 1: 0, 2: 2, 3: 0, 4: 53}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!