ID: 908723219_908723227

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 908723219 908723227
Species Human (GRCh38) Human (GRCh38)
Location 1:67148182-67148204 1:67148228-67148250
Sequence CCTGCCGGATCCAGAGGGGTGGA CGGCAATCAGCAGTAGTGGACGG
Strand - +
Off-target summary No data {0: 1, 1: 4, 2: 77, 3: 149, 4: 131}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!