ID: 908751276_908751281

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 908751276 908751281
Species Human (GRCh38) Human (GRCh38)
Location 1:67426153-67426175 1:67426180-67426202
Sequence CCTCCTTCACCCTTTTCTTCAAG TTTTCGAATCTTCGTTCACGAGG
Strand - +
Off-target summary {0: 3, 1: 1, 2: 5, 3: 45, 4: 470} {0: 1, 1: 1, 2: 2, 3: 5, 4: 43}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!