ID: 908751277_908751282

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 908751277 908751282
Species Human (GRCh38) Human (GRCh38)
Location 1:67426156-67426178 1:67426183-67426205
Sequence CCTTCACCCTTTTCTTCAAGTGG TCGAATCTTCGTTCACGAGGTGG
Strand - +
Off-target summary {0: 2, 1: 2, 2: 2, 3: 32, 4: 322} {0: 1, 1: 1, 2: 2, 3: 4, 4: 13}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!