ID: 908806353_908806357

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 908806353 908806357
Species Human (GRCh38) Human (GRCh38)
Location 1:67937076-67937098 1:67937101-67937123
Sequence CCTTCTTCTGCTTTCTTGTTCTG TGGGCCCCCATATGATTGGATGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 10, 3: 164, 4: 1288} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!