ID: 908934824_908934830

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 908934824 908934830
Species Human (GRCh38) Human (GRCh38)
Location 1:69362656-69362678 1:69362684-69362706
Sequence CCTCCCACTTTCCCATTCGACAG TCCAGATTCCAAACAACATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 138} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!