ID: 908954106_908954116

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 908954106 908954116
Species Human (GRCh38) Human (GRCh38)
Location 1:69600299-69600321 1:69600349-69600371
Sequence CCCAGAGAATCATCCAGGATATC TTGTTGCCATAGGCTCCTCTTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 28, 4: 226}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!