ID: 908997920_908997923

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 908997920 908997923
Species Human (GRCh38) Human (GRCh38)
Location 1:70180358-70180380 1:70180381-70180403
Sequence CCAGAACTCCCTAGGCTCAAGCG ATCCTCCTGCCTCAGCCACCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 24, 3: 449, 4: 4183} {0: 3, 1: 332, 2: 3708, 3: 4035, 4: 3664}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!