ID: 909153162_909153165

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 909153162 909153165
Species Human (GRCh38) Human (GRCh38)
Location 1:72034913-72034935 1:72034929-72034951
Sequence CCAGCAGCTGTACCTGGAAGCCA GAAGCCAGGTACATTCAATATGG
Strand - +
Off-target summary No data {0: 12, 1: 14, 2: 31, 3: 67, 4: 194}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!