ID: 909486250_909486254

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 909486250 909486254
Species Human (GRCh38) Human (GRCh38)
Location 1:76177840-76177862 1:76177855-76177877
Sequence CCGTGCTCCACGGATTTCATCAC TTCATCACTCTTGAGTGACGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 74} {0: 1, 1: 0, 2: 0, 3: 6, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!