ID: 909551697_909551702

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 909551697 909551702
Species Human (GRCh38) Human (GRCh38)
Location 1:76905159-76905181 1:76905206-76905228
Sequence CCCTAAAGATAGAGAGCACATCG AGGGGTAGAGACTCTGAGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 109} {0: 1, 1: 0, 2: 7, 3: 56, 4: 377}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!