ID: 909636405_909636412

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 909636405 909636412
Species Human (GRCh38) Human (GRCh38)
Location 1:77821257-77821279 1:77821292-77821314
Sequence CCATTAAGCCACATCTTCCCTCA CAGTTGTTCTTTTGGACCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 249} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!