ID: 909695254_909695264

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 909695254 909695264
Species Human (GRCh38) Human (GRCh38)
Location 1:78461333-78461355 1:78461372-78461394
Sequence CCTTGCTGTAGTTGTTTATCAGG TAGAGACTATGGGGATTTTTAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 75, 4: 267} {0: 1, 1: 2, 2: 18, 3: 164, 4: 467}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!