ID: 910163422_910163423

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 910163422 910163423
Species Human (GRCh38) Human (GRCh38)
Location 1:84298498-84298520 1:84298514-84298536
Sequence CCGGGGCTTTGCGCGTGGCGGCC GGCGGCCGCCGAGCTCCGCGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 69} {0: 1, 1: 0, 2: 5, 3: 24, 4: 186}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!