ID: 910282639_910282644

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 910282639 910282644
Species Human (GRCh38) Human (GRCh38)
Location 1:85518355-85518377 1:85518385-85518407
Sequence CCTTCCTGTACAGTCTAAGAGAA TTCCCTGCTCGTTCAGGTGTTGG
Strand - +
Off-target summary No data {0: 2, 1: 0, 2: 0, 3: 9, 4: 102}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!