ID: 910320942_910320952

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 910320942 910320952
Species Human (GRCh38) Human (GRCh38)
Location 1:85943248-85943270 1:85943298-85943320
Sequence CCATGGTCCTGAGGCCTTTGTAC CAGGGTCTCCAGTTTGCAGATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 33, 3: 133, 4: 456} {0: 3, 1: 30, 2: 187, 3: 387, 4: 778}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!